Wednesday, February 28, 2007

The Popsicle Twins

Last night, I was watching a Gameshow network show about Chuck Barris (about whom the excellent movie Confessions of a Dangerous Mind was made) and was reminded of the infamous Popsicle Twin act that I have heard may have played a part in helping get The Gong Show pulled off the air. (Look up "controversial acts" in the wikipedia entry for The Gong Show.)

In looking at the wikipedia entry, I see that some of the legitimate talent that appeared on The Gong Show was The Mystic Knights of the Oingo Boingo, an awesome (!!!!!) musical band later known by a slightly shorter name, Paul Reubens, who usually goes under a somewhat different stage name ("Tell them 'Large Marge' sent you."), RuPaul, and Michael Winslow. (Actually, I vaguely remember seeing a clip with Michael Winslow on that show.)

Monday, February 26, 2007

The Cult of Genius

Here is Gazebo's post about the cult of genius.

It links to some excellent comments in Cosmic Variance and Uncertain Principles about the Cult of Genius in physics and the messages that we should be giving to our students.

I have had a number of discussions over the years with friends, students, and colleagues about stuff like this because this really is something that discourages people to continue in science. Just who the fuck came up with the idea that you have to be a genius to be a successful physicist (or any kind of scientist, for that matter) because that's dead wrong. It helps to be smart -- don't get me wrong -- but I have seen way too many students turn away from science because they are wrongly led to believe this. And it's a bloody shame.

It's easy to see this among undergrads at Caltech. We all know plenty of people who were brilliant but got turned off for one reason or another, and you certainly shouldn't go away from science if/when you find out you're not a genius. Almost all of us find this out at some point because few people actually are geniuses, and coming to grips with this can be very difficult. I know a lot of people at Tech who couldn't do this or needed many years to do it. (A couple of the smartest people I have ever met flamed out of Tech. They are easily on par in terms of "pure intelligence" with numerous people I've met who have tenure-track jobs at the best schools in the world.)

Now, it would be nice if New York Times didn't portray subjects like string theory which tend to have very high barriers to entry as the pinnacle of human achievement -- personally, I greatly prefer nonlinear dynamics and complex systems -- but let's be realistic: newspapers are going to continue glorifying bullshit like that, so what do we do as teachers? Well, when I screw up, I let my students know. Admitting mistakes -- what a concept! Part of the reason I do this is that I know they will struggle sometimes (maybe a lot), and I want them to know that I still struggle too. I've been "successful" and have a great job waiting for me, but that doesn't mean that I didn't fuck up pretty majorly on occasion and that some of those occasions are pretty damned recent. And of course that I still make tons of mistakes. It's important to convey the idea that you can make mistakes and still get extremely far. These scientists who have poles up their asses and want their students to think that they're impervious to fallacies aren't helping anybody.

In fact, one of the most important things I learned in grad school was that all these so-called geniuses with stuff named after them aren't any better than I am. (OK, there are a few freaks who are, but I'm a theorist and get to drop people on the extreme of the distribution.) They struggled just like I did. And I want my students to know that I struggled and that I continue to struggle. It's not a cake-walk for any but an exceedingly small number of people, so why are we giving the very damaging impression that it is.

So, if you're a student of mine (and I know some of you read my blog on occasion), please read the content in the links above. I'm afraid I wasn't overly coherent in this post, but there are some important issues here. This is a marathon, not a sprint. The most important thing you can do is work your ass off.

Grand Unification Theory (sort of)

Check out the first sentence in the abstract of this recently-posted arxiv paper:

------------------------------------------------------------------------------
\\
Paper: cond-mat/0702584
Date: Mon, 26 Feb 2007 05:34:14 GMT (270kb)

Title: Modelling of self-driven particles: foraging ants and pedestrians
Authors: Katsuhiro Nishinari, Ken Sugawara, Toshiya Kazama, Andreas
Schadschneider, Debashish Chowdhury
Categories: cond-mat.stat-mech
Comments: 15 pages, 11 Postscript figures, uses elsart.cls
Subj-class: Statistical Mechanics
Journal-ref: Physica A vol.372 (2006) pp.132-141
\\
Models for the behavior of ants and pedestrians are studied in an unified way
in this paper. Each ant follows pheromone put by preceding ants, hence creating
a trail on the ground, while pedestrians also try to follow others in a crowd
for efficient and safe walking. These following behaviors are incorporated in
our stochastic models by using only local update rules for computational
efficiency. It is demonstrated that the ant trail model shows an unusual
non-monotonic dependence of the average speed of the ants on their density,
which can be well analyzed by the zero-range process. We also show that this
anomalous behavior is clearly observed in an experiment of multiple robots.
Next, the relation between the ant trail model and the floor field model for
studying evacuation dynamics of pedestrians is discussed. The latter is
regarded as a two-dimensional generalization of the ant trail model, where the
pheromone is replaced by footprints.
\\ ( http://arXiv.org/abs/cond-mat/0702584 , 270kb)
------------------------------------------------------------------------------

Maybe the sequel will be about glomming? Flocking and swarming are pretty hot topics these days...

Overheard in Firestone

The following was uttered by a grad turkey a few minutes after noon today as we were trying to figure out if Tom Hou would show up to lecture today's ACM 210a make-up class:

"Sheila's probably gone too, which means we have no hope of finding anyone."


By the way, learning about make-up is extremely applied. It helps with the level-set method as well.

Sunday, February 25, 2007

New issue of SIAM Review + Congrats!

I was talking to Zifnab at lunch on Thursday (am I remembering the day correctly?) and I asked him when his article was officially coming out (of the closet, of course). The very next day, I received my new issue of SIAM Review in the mail, and his article is contained therein and given some major highlights in the section of the journal containing it.

The editor of the relevant section had a lot of complimentary things to say about the article. (Z: Do you want to add anything to the editor's description?)

I also noticed something else interesting in this issue of SIREV -- namely, that the article The Mathematics of Phylogenomics (by Lior Pachter '94 and Bernd Sturmfels) includes Hitchhiker's Guide in the bibliography. So I decided to look through the article and figure out why, and the answer is pretty interesting:

Conjecture 1 (the “Meaning of Life”). The sequence of 42 bases
(2.1) TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG
was present in the genome of the ancestor of all vertebrates, and it has been completely
conserved to the present time (i.e., none of the bases have been mutated, nor have there
been any insertions or deletions).


Alert readers have indubitably already figured out the connection by now, but let me nevertheless duplicate a few more words from the article:

In 2003, the sequence (2.1) appeared to be the longest completely conserved
sequence among the vertebrates. We were amused to find that its length was 42.
In light of [1], it was decided to name this DNA sequence “The Meaning of Life.”


I approve!

Friday, February 23, 2007

Conservapedia

Here is the straight line; you provide the joke:

Gazebo reports on a project called Conservapedia, which is supposed to be the Conservatives' answer to the "liberally-biased" Wikipedia.

You can read what Gazebo (and the people to whom he linked) wrote about this. I think the only reaction I want to add is Sighhhhhhhhhhhh....

There's got to be a good joke to go with this...

Or maybe Gazebo can write another comic strip for this one.

The term of the day is "ZZ topology". OK, it's not a real term, but in my current tired state, I noticed an article whose first two words are "Z2 topological" (the e-mail was in plain text, so the latex formatting wasn't present) and I misread it as "ZZ topological".

So, what would a ZZ topology look like? :)

Tuesday, February 20, 2007

Thesis title of the day

Here's a real winner: "Detection of Single Quantized Vortex Lines in Rotating HeII" (by Richard Packard, 1969)

When I first read this, I thought "He II" was "Hell". I didn't know that Hell could rotate.

Gazebo should be familiar with the author, and I actually have a good scientific reason to be at his web page. (I'm trying to look up some results of his from the 80s.)

Update: Inspired by this post, Gazebo made a Dinosaur Comic about "Rotating Hell". I approve!

Another quote

This comes from the always amusing Maciej Zworski, who was giving a talk today in the local mathematical physics meeting.

Zworski's comment was: "It is a theorem from algebraic geometry that all log-log plots look like a straight line."

This is, of course, very close to my heart because of all the power law nonsense I see in the networks literature.

Overheard at Lunch

"I'm going to get the implants in Romania because it's cheaper there." -- Catalin Turc

Quote of the Day (revised)

OK, I need to replace my other so-called quote of the day

I was just talking to one of my friends on the phone. He uttered the immortal phrase, "If I had a pocket protector and breasts, I would have been more likely to see you by now."

He was referring to the fact that I haven't been as available recently during the current spike in editing I've had. And in all honesty, I don't think I can particularly refute his statement.

Monday, February 19, 2007

Quote of the Day

Today's quote comes from me during a meeting I was having with a couple of my collaborators: "I don't give a shit if people think I'm smart. I have a job." This was unpremeditated and while not necessarily tactless per se, I think it's fair to classify that under the more general rubric of 'honest to a fault' that is what I really follow. Even more accurately, my filters didn't work again. (You know, the ones that pretty much never work except to point out that I probably shouldn't have said what I just uttered.)

And yes, I had a two-hour meeting on a holiday... because we all have lives. I put in a full work day at the office today, and even set my alarm for 9 am so that I wouldn't miss a seminar I wanted to see. (That's right, the first day of a mathematical physics meeting transpired on campus today... because those people all have lives as well.) When I was getting ready in the morning, I played my stereo loudly as usual, except unlike most mornings, other people were actually trying to sleep at the time and that hadn't occurred to me. [Ordinarily, I'll get up late enough during a weekday that others will already be gone or at least not trying to sleep in and I'll consciously not do this if I get up earlier. On a weekend, I'll typically get up late enough that this won't be an issue.] So because of my little screw-up, the landlady fielded complaints that were passed on to me. Naturally, I feel like an ass because all I could do was sheepishly apologize for being a dumbass. I can't take back the fact that I bothered people. Sigh...

Now I'm working on my book a bit. I should finish my first pass of the stories from this round of editing and then I can go back to the beginning of the loop and take a look at my coauthors adjustments to my text. We're gradually approaching the end of the line. The text should be in the hands of the layout person reasonably soon. Then we'll get page proofs, put out any new fires that arise, and send this off to the printers and discuss things like some of the proceeds going to a prank fund and so on.

Oh, and it looks like I may be writing up another paper pretty soon. Based on the discussion today, it looks like we are nearing the point that we have a coherent story to tell. Though I wished my parts had worked out better. I did get a couple things to work, but I keep feeling guilty and asking to be put farther down the author list to a spot that I feel is more appropriate.

Update: This quote of the day has been officially replaced by something one of my friends subsequently said.

Saturday, February 17, 2007

iTunes Prose (random 11)

In a twist on the usual random music selections from iTunes to determine fortunes, New Year's resolutions, and so on, I offer the following alternative. This idea dawned during an IM conversation I was having with Lemming during which I was quoting even more song lyrics than usual.

I loaded up iTunes, played the first 11 songs (it was going to be 10, but one of the songs didn't have any lyrics), took some lines from the songs (and the title of the song that didn't have any lyrics), and composed a story using them. I was originally going to make a poem, but I decided that prose would be a lot easier.

Here is the story. I actually kind of like it, especially given the constraints under which I was working. I hope you enjoy it.

Now, let's play a game. Your mission, if you choose to accept it, is to figure out the identity of those 11 songs (artist and title) and which lines go with which for the 10 that have lyrics.

Mad props go out to Lemming for his major role in coming up with this idea.

Friday, February 16, 2007

Download rankings (Chaos), 12/06

One of my articles, Community structure in the U.S. House of Representatives, was the 19th most downloaded article in the journal Chaos in December 2006 even though it was not posted until December 15th. That's not bad.

Thursday, February 15, 2007

Today's fortune

My fortune cookie dissed me today: "You have given some thought to a different life style."

Wednesday, February 14, 2007

Tales from the arXiv: Best. Title. Ever.

The following paper just got posted on the arXiv. It has the best title ever.

------------------------------------------------------------------------------
\\
Paper: cond-mat/0702338
Date: Wed, 14 Feb 2007 16:11:37 GMT (231kb)

Title: Reply to Comment
Authors: Lu Li, Yayu Wang, M. J. Naughton and N. P. Ong
Categories: cond-mat.supr-con cond-mat.str-el
Comments: 1 page, 1 figure, submitted to PRL
Subj-class: Superconductivity; Strongly Correlated Electrons
\\
Our experiments \cite{Wang05,Li05,Wang06} persuade us that the Meissner
transition at $T_c$ in hole-doped cuprates is driven by the loss of long-range
phase coherence caused by singular phase fluctuations, a scenario at odds with
the mean-field (MF), Gaussian Ginzburg Landau (GGL) approach advocated by Cabo,
Mosquiera and Vidal \cite{Cabo}.
\\ ( http://arXiv.org/abs/cond-mat/0702338 , 231kb)
------------------------------------------------------------------------------


In fact, the paper itself has this title. It isn't just a typo!


This has me thinking that perhaps I should call my next paper, "To Hell with you Assholes!"

Tuesday, February 13, 2007

It's apparently "flaming red month"

Here is the straight line: I received an email from some sort of association of local Cornell alums. Apparently, this month is flaming red and we're supposed to celebrate it.

You provide the joke.

(Context: red is the Cornell color. 'Go Big Red' is actually not just what Fleming uses --- it's also what Cornell uses.)

Monday, February 12, 2007

Overheard in ACM 210a

In ACM 210a today, Professor Tom Hou said, "You don't want to jump the shock."

This is my quote of the day, and it will require some unraveling to convey the full significance.

First of all, it immediately made me think of the phrase jump the shark, an appreciation of which is required to fully enjoy the quote above. If you don't know what that phrase means -- and most of you should because I've discussed it on my blog before -- you owe it to yourself to take a look at the wikipedia entry on the other side of the link I provided.

The topic of the class is numerical methods for partial differential equations, and in the class of systems we're studying right now shocks are very common. When designing numerical schemes to deal with systems that can have this stuff, they typically have to be lower-order near the shock because if you're going to use nearby points for interpolation, you don't want points on both sides of the shock. That is, you don't want to jump the shock. Thus, Hou's comment (which was completely intentional) makes absolutely perfect sense scientifically. Moreover, he is as far as I can tell completely unaware of the term "jumping the shark," so it seems that he doesn't realize just how funny that comment is.

If I ever discuss the numerics of such systems in a talk, I am so going to use the picture of the Fonz jumping the shark on one of my slides. Maybe only one or two people in the audience will get the joke because it admittedly requires a reference leap, but it is bloody awesome!

Sunday, February 11, 2007

100,000th web site visit

My website received its 100,000th unique visitor today.*

Let me specify what I mean by "unique" here. It doesn't mean that 100,000 different IP addresses have visited my site, so (for example) if one IP address visited my site on two different days, that would count as 2 visits. However, if on one of those occasions, the visitor looked at 10 different pages, the 10 hits would constitute 1 unique visit.

I started using this counter while I was at Cornell, this is many years worth of visiting. I originally used a different counter when I made the first version of this web, and the 100,000 does not include any of those hits (which were counted somewhat differently).

Not that any of this matters...

Perverted by Physicists

I'm about to do a calculation in which I am going to subtract off an infinity. Every mathematical bone in my body is rebelling against the very idea of doing this. (It's justified physically but it still irks me.)

It is things like these that occasionally remind me that -- despite my research interests, lack of theorem-proof style, present affiliation, and so on -- in my body beats the heart of a mathematician. (I ripped it out of him, but that's a story for another time.)