I was talking to Zifnab at lunch on Thursday (am I remembering the day correctly?) and I asked him when his article was officially coming out (of the closet, of course). The very next day, I received my new issue of SIAM Review in the mail, and his article is contained therein and given some major highlights in the section of the journal containing it.
The editor of the relevant section had a lot of complimentary things to say about the article. (Z: Do you want to add anything to the editor's description?)
I also noticed something else interesting in this issue of SIREV -- namely, that the article The Mathematics of Phylogenomics (by Lior Pachter '94 and Bernd Sturmfels) includes Hitchhiker's Guide in the bibliography. So I decided to look through the article and figure out why, and the answer is pretty interesting:
Conjecture 1 (the “Meaning of Life”). The sequence of 42 bases
(2.1) TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG
was present in the genome of the ancestor of all vertebrates, and it has been completely
conserved to the present time (i.e., none of the bases have been mutated, nor have there
been any insertions or deletions).
Alert readers have indubitably already figured out the connection by now, but let me nevertheless duplicate a few more words from the article:
In 2003, the sequence (2.1) appeared to be the longest completely conserved
sequence among the vertebrates. We were amused to find that its length was 42.
In light of [1], it was decided to name this DNA sequence “The Meaning of Life.”
I approve!
20 hours ago
4 comments:
Excellent! I'm glad it's finally available in print. :) I don't have much to add to the editor's description, it's pretty much a concise (hah) summary. I would note that i'm not the primary author (probably obvious if anyone has gone to look at it). I did a lot of the work on the representation theorem, and bits and pieces elsewhere. :)
Congrats, Z! I'm gonna have to gank (old use of the term) that copy from Mason when he's done with it.
Of course the HHGttG bit is also a serious amusement-inducer.
I need "gank" explained to me. What are the old and new meanings?
I am done with that copy. I don't have time to read the article carefully at the moment. Also, you can just download it from the links I gave you. (Caltech has a site license, so you should hit the article automatically from campus. Then you can just print it out.)
You're welcome to borrow the copy I got in the mail if you want, but I'd like it back when you're done. (I specifically want to save it.)
Congratulations Zifnab!
Post a Comment