I was talking to Zifnab at lunch on Thursday (am I remembering the day correctly?) and I asked him when his article was officially coming out (of the closet, of course). The very next day, I received my
new issue of
SIAM Review in the mail, and his article is contained therein and given some major highlights in the section of the journal containing it.
The editor of the relevant section had
a lot of complimentary things to say about the article. (Z: Do you want to add anything to the editor's description?)
I also noticed something else interesting in this issue of
SIREV -- namely, that the article
The Mathematics of Phylogenomics (by Lior Pachter '94 and Bernd Sturmfels) includes
Hitchhiker's Guide in the bibliography. So I decided to look through the article and figure out why, and the answer is pretty interesting:
Conjecture 1 (the “Meaning of Life”). The sequence of 42 bases
(2.1) TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG
was present in the genome of the ancestor of all vertebrates, and it has been completely
conserved to the present time (i.e., none of the bases have been mutated, nor have there
been any insertions or deletions).Alert readers have indubitably already figured out the connection by now, but let me nevertheless duplicate a few more words from the article:
In 2003, the sequence (2.1) appeared to be the longest completely conserved
sequence among the vertebrates. We were amused to find that its length was 42.
In light of [1], it was decided to name this DNA sequence “The Meaning of Life.”I approve!
